Phones
Phones

Phones

What To Do
What To Do

What To Do

When Your
When Your

When Your

Proofs
Proofs

Proofs

Dont Know
Dont Know

Dont Know

Meme Smile
Meme Smile

Meme Smile

Publicated
Publicated

Publicated

Minionator
Minionator

Minionator

Fluffiness
Fluffiness

Fluffiness

So Wrong
So Wrong

So Wrong

🔥 | Latest

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, “once in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)
America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, “once in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)

SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East...

Hoes, Life, and Memes: ONE GOOD GIRL IS WORTH A THOUSAND HOES When people ask me about the most important factor for achieving financial success, my response usually takes them by surprise. Idk, maybe they expect me to say that what’s most important for your financial freedom is living within your means, investing early, or creating a financial plan. While those are important, in my opinion, nothing is more essential to your financial success than the person you share your life with. - (I’m not gonna be Hitch for you but keep reading) - So, what should you look for in a woman? Here’s basic set of character traits which will also be good for your financial life together. 😉 ✔️High self-esteem. Having self-esteem means that you take pride and value yourself without being arrogant. You don’t let other people mistreat you or take you for granted. ✔️Responsibility. Being responsible is taking care of yourself without relying on other people to remind you when to be somewhere or what to do. Responsible people know they’re in charge of their lives and get things done on time, like showing up for work, paying bills, and managing finances. ✔️Openness. Openness is a trait that’s similar to honesty, but has more to do with emotional intelligence. An open person is aware of his or her feelings, can express them, and wants to communicate in order to keep an emotional connection. - To sum up, high self-esteem, responsibility, openness, are my top 5 recommended traits to look for when you’re choosing a life partner. Of course, there are many more traits that many of us want such as intelligence, honesty. sense of humor, positive attitude, common interests, and similar backgrounds. - Have you found the one? 😉 Comment below! - theone perfect life millionairementor
Hoes, Life, and Memes: ONE GOOD GIRL IS
 WORTH A THOUSAND HOES
When people ask me about the most important factor for achieving financial success, my response usually takes them by surprise. Idk, maybe they expect me to say that what’s most important for your financial freedom is living within your means, investing early, or creating a financial plan. While those are important, in my opinion, nothing is more essential to your financial success than the person you share your life with. - (I’m not gonna be Hitch for you but keep reading) - So, what should you look for in a woman? Here’s basic set of character traits which will also be good for your financial life together. 😉 ✔️High self-esteem. Having self-esteem means that you take pride and value yourself without being arrogant. You don’t let other people mistreat you or take you for granted. ✔️Responsibility. Being responsible is taking care of yourself without relying on other people to remind you when to be somewhere or what to do. Responsible people know they’re in charge of their lives and get things done on time, like showing up for work, paying bills, and managing finances. ✔️Openness. Openness is a trait that’s similar to honesty, but has more to do with emotional intelligence. An open person is aware of his or her feelings, can express them, and wants to communicate in order to keep an emotional connection. - To sum up, high self-esteem, responsibility, openness, are my top 5 recommended traits to look for when you’re choosing a life partner. Of course, there are many more traits that many of us want such as intelligence, honesty. sense of humor, positive attitude, common interests, and similar backgrounds. - Have you found the one? 😉 Comment below! - theone perfect life millionairementor

When people ask me about the most important factor for achieving financial success, my response usually takes them by surprise. Idk, maybe t...

Alive, Amazon, and Apple: did you know? You can buy wrapping paper that's covered in the lyrics of classic rap and hip hop songs. 'Gift Rap' comes in a variety of stvles, including Baby Got Back, Whoomp! (There it is!), O. P. P., and Push It rl keep my women like Flo Jo/A word to the thick soul sisters, I want to lay cause l'm long, and I'm strong and I'm down to get the friction on/S to do with my selection/Thirty six-twenty four- thirty six/ Ha ha, oe but please don't lose that butt/Some brothers want to play that has Eck in, to the beanpole dames in the magazines / You ain't it miss thing / and you want a triple X throw down/ Dial 1-900-MIKALOT and kici guys?/They only talk to her because she looks like a total prostitute, bitty waist and a round thang in your face, you get sprung/Wanna pu es (me so horny)/0000 rump of smooth skin/You say you wanna the average black man and ask him that she's gotta pack much bac h the Oakland booty)/llike 'em round and big and when I'm throwir so fine that you'll see Double Mix-a-Lot's in trouble- beggin' for a pi l gotta be straight when I say l want to/Til the break of dawn- baby g vanna roll in my Mercedes? (yeah)/ Then turn around, stick it out, even w Honda, playin' workout tapes by Fonda/ But Fonda ain't got a motor in o they toss it and leave it andI pull up quick to retrieve it/So Cosmo says and rice didn't miss her/Some knuckleheads try to dis 'cause his gir Baby got back /Little in the middle but she got much back I/ Oh m Ican't believe it's just so round /It's like out there/Imean gross/Look [was stuffed deep in the peans she's wearin. / I'm hooked and I can't stop cause you ain't that average groupie/I saw her dancin', to hell with rom ur girlfriend got the butt? (hel yeah)/Tell 'em to shake it (shake it), shal like an animal, now here's my scandal/I want to got you home and uh, d PHOTO: AMAZON DIDYOUKNOWFACTS.COM What a time to be alive! 🎁 presents wrapping giftrap funny 📢 Share the knowledge! Tag your friends in the comments. ➖➖➖➖➖➖➖➖➖➖➖ Want more Did You Know(s)? ➡📓 Buy our book on Amazon: [LINK IN BIO] ➡📱 Download our App: http:-apple.co-2i9iX0u ➡📩 Get daily text message alerts: http:-Fact-Snacks.com ➡📩 Free email newsletter: http:-DidYouKnowFacts.com-Sign-Up- ➖➖➖➖➖➖➖➖➖➖➖ We post different content across our channels. Follow us so you don't miss out! 📍http:-facebook.com-didyouknowblog 📍http:-twitter.com-didyouknowfacts ➖➖➖➖➖➖➖➖➖➖➖ DYN FACTS TRIVIA TIL DIDYOUKNOW NOWIKNOW
Alive, Amazon, and Apple: did you know?
 You can buy wrapping paper that's
 covered in the lyrics of classic rap and
 hip hop songs. 'Gift Rap' comes in a
 variety of stvles, including Baby Got
 Back, Whoomp! (There it is!), O. P. P.,
 and Push It
 rl keep my women like Flo Jo/A word to the thick soul sisters, I want to
 lay cause l'm long, and I'm strong and I'm down to get the friction on/S
 to do with my selection/Thirty six-twenty four- thirty six/ Ha ha, oe
 but please don't lose that butt/Some brothers want to play that has
 Eck in, to the beanpole dames in the magazines / You ain't it miss thing /
 and you want a triple X throw down/ Dial 1-900-MIKALOT and kici
 guys?/They only talk to her because she looks like a total prostitute,
 bitty waist and a round thang in your face, you get sprung/Wanna pu
 es (me so horny)/0000 rump of smooth skin/You say you wanna
 the average black man and ask him that she's gotta pack much bac
 h the Oakland booty)/llike 'em round and big and when I'm throwir
 so fine that you'll see Double Mix-a-Lot's in trouble- beggin' for a pi
 l gotta be straight when I say l want to/Til the break of dawn- baby g
 vanna roll in my Mercedes? (yeah)/ Then turn around, stick it out, even w
 Honda, playin' workout tapes by Fonda/ But Fonda ain't got a motor in
 o they toss it and leave it andI pull up quick to retrieve it/So Cosmo says
 and rice didn't miss her/Some knuckleheads try to dis 'cause his gir
 Baby got back /Little in the middle but she got much back I/ Oh m
 Ican't believe it's just so round /It's like out there/Imean gross/Look
 [was stuffed deep in the peans she's wearin. / I'm hooked and I can't stop
 cause you ain't that average groupie/I saw her dancin', to hell with rom
 ur girlfriend got the butt? (hel yeah)/Tell 'em to shake it (shake it), shal
 like an animal, now here's my scandal/I want to got you home and uh, d
 PHOTO: AMAZON
 DIDYOUKNOWFACTS.COM
What a time to be alive! 🎁 presents wrapping giftrap funny 📢 Share the knowledge! Tag your friends in the comments. ➖➖➖➖➖➖➖➖➖➖➖ Want more Did You Know(s)? ➡📓 Buy our book on Amazon: [LINK IN BIO] ➡📱 Download our App: http:-apple.co-2i9iX0u ➡📩 Get daily text message alerts: http:-Fact-Snacks.com ➡📩 Free email newsletter: http:-DidYouKnowFacts.com-Sign-Up- ➖➖➖➖➖➖➖➖➖➖➖ We post different content across our channels. Follow us so you don't miss out! 📍http:-facebook.com-didyouknowblog 📍http:-twitter.com-didyouknowfacts ➖➖➖➖➖➖➖➖➖➖➖ DYN FACTS TRIVIA TIL DIDYOUKNOW NOWIKNOW

What a time to be alive! 🎁 presents wrapping giftrap funny 📢 Share the knowledge! Tag your friends in the comments. ➖➖➖➖➖➖➖➖➖➖➖ Want more Di...

America, Bad, and Bad Jokes: HAPPY NEW YEAR!!! 2017 brought us many things...... Like snowflakes, safe spaces, multiple gender identities, protests, trigger words, etc Worries over President Trump starting World War 3, Deporting 11 million people in the country illegally, Eliminating guarantees of equal status for women, And, fears of him plunging the country into recession. It also brought us conversations about patriotism and racism and how monuments and words hurt feelings.... It brought MORE kneeling during OUR COUNTRIES ANTHEM, MORE sexual assault scandals by the lowest forms of men than you can possibly count, VIRAL videos of bullied children, child hangings, live kidnappings, and pretty much anything that has to do with bad jokes lol Soooooo in saying that I thought I would start off 2018 with a BANG and HURT a few feelings👍🏻 To ALL the Haters of Pride in Country and Patriotism in General.... REAL Americans know why you don’t like us....We really do. We represent everything that you can’t stand. The love of Freedom.....REAL Freedom not Entitlement that you sometimes get confused✔️ The love of Country.....REAL love that doesn’t waiver just because America may not get it right ALL the time✔️ The characteristic of saying what We Feel....REALLY what We Feel and not worry about your “Political Correctness” that you claim We don’t have✔️ To be honest, We couldn’t be happier that We don’t......because the only reason we have “Poltical Correctness” is to protect others from hearing what we actually think because it may hurt their “feelings”👍🏻 We say what we say and We feel how We feel....We have never and will never expect everyone to agree with us on everything, but that’s the whole point and the REAL idea of actual discussion.....people having different views! So here is wishing for an even BIGGER and BETTER 2018 where REAL AMERICANS bring back pride in our country and love of Freedom and everything that America is SUPPOSED to represent!! And to everyone that is offended by everything..... THIS ONE’S FOR YOU😉 Happy New Year!!! -Graham🇺🇸 happynewyear 2018 freedom usa 2a veteran
America, Bad, and Bad Jokes: HAPPY NEW YEAR!!! 2017 brought us many things...... Like snowflakes, safe spaces, multiple gender identities, protests, trigger words, etc Worries over President Trump starting World War 3, Deporting 11 million people in the country illegally, Eliminating guarantees of equal status for women, And, fears of him plunging the country into recession. It also brought us conversations about patriotism and racism and how monuments and words hurt feelings.... It brought MORE kneeling during OUR COUNTRIES ANTHEM, MORE sexual assault scandals by the lowest forms of men than you can possibly count, VIRAL videos of bullied children, child hangings, live kidnappings, and pretty much anything that has to do with bad jokes lol Soooooo in saying that I thought I would start off 2018 with a BANG and HURT a few feelings👍🏻 To ALL the Haters of Pride in Country and Patriotism in General.... REAL Americans know why you don’t like us....We really do. We represent everything that you can’t stand. The love of Freedom.....REAL Freedom not Entitlement that you sometimes get confused✔️ The love of Country.....REAL love that doesn’t waiver just because America may not get it right ALL the time✔️ The characteristic of saying what We Feel....REALLY what We Feel and not worry about your “Political Correctness” that you claim We don’t have✔️ To be honest, We couldn’t be happier that We don’t......because the only reason we have “Poltical Correctness” is to protect others from hearing what we actually think because it may hurt their “feelings”👍🏻 We say what we say and We feel how We feel....We have never and will never expect everyone to agree with us on everything, but that’s the whole point and the REAL idea of actual discussion.....people having different views! So here is wishing for an even BIGGER and BETTER 2018 where REAL AMERICANS bring back pride in our country and love of Freedom and everything that America is SUPPOSED to represent!! And to everyone that is offended by everything..... THIS ONE’S FOR YOU😉 Happy New Year!!! -Graham🇺🇸 happynewyear 2018 freedom usa 2a veteran

HAPPY NEW YEAR!!! 2017 brought us many things...... Like snowflakes, safe spaces, multiple gender identities, protests, trigger words, etc W...

Bless Up, God, and Life: This adorable puppy with a cast. Pic: reddit u/oddfuture445 @DrSmashlove PSA: NEW YEAR MEANS NOTHING. SORRY TO BREAK IT TO U BUT THAT’S FACTUAL. DON’T BE HARD ON YOURSELF FOR WHAT U DIDN’T ACCOMPLISH LAST YEAR. DON’T PUT AN UNREASONABLE AMOUNT OF PRESSURE ON YOURSELF TO OVER-PERFORM THIS COMING YEAR. IT’S ARBITRARY. NOBODY GETS THEY LIFE RIGHT IN JANUARY. ACTUALLY, NOBODY GIVE A FVCK ABOUT JANUARY BRUV ALL U DO IN JANUARY IS BE A LITTLE DEPRESSED AT THE COLD AND LACK OF HOLIDAY DAYS OFF AND TRY TO MAYBE HIT SOME NICE 60% OFF SALES. THAT’S IT. THAT’S THE HAPPIEST U GON GET IN JANUFVCKINGWARY. “Oh wow this John Elliott jacket is a little on sale lemme cop this” THAT’S THE HIGH POINT OF JANUARY - SPOILER ALERT. NOBODY LOSING 78 POUNDS IN MF JANUARY. THAT’S WHAT U DO IN AUGUST. LITERALLY. MY LIL HOMEGIRL DROPPED LIKE 18 POUNDS IN AUGUST AND I’M LIKE “SEE? ‘Years’ HAVE NOTHING TO DO WITH IT!” GOD RAINS DOWN THE BLESSINGS ON *HIS* TIMELINE NOT ON THE BASIS OF THE GREGORIAN CALENDAR WHICH IS A MAN-MADE CONSTRUCT. NO OFFENSE TO THE GREGORIANS BUT WHO TF ARE THEY ANYWAY? NOBODY CLAIM THEM. GREGORIA AIN’T EVEN A COUNTRY. EXACTLY. NOW GO LIVE YA BEST LIFE AND BE NICE AND GIVE TO CHARITY AND CALL YA MAMA WHO SUFFER FROM DEPRESSION AND BIPOLAR AND TELL HER U LOVE HER AND MAY GOD ALWAYS BLESS U - IN 2018 AND BEYOND - BLESS UP ❤️😍😂
Bless Up, God, and Life: This adorable puppy with a cast.
 Pic: reddit u/oddfuture445
 @DrSmashlove
PSA: NEW YEAR MEANS NOTHING. SORRY TO BREAK IT TO U BUT THAT’S FACTUAL. DON’T BE HARD ON YOURSELF FOR WHAT U DIDN’T ACCOMPLISH LAST YEAR. DON’T PUT AN UNREASONABLE AMOUNT OF PRESSURE ON YOURSELF TO OVER-PERFORM THIS COMING YEAR. IT’S ARBITRARY. NOBODY GETS THEY LIFE RIGHT IN JANUARY. ACTUALLY, NOBODY GIVE A FVCK ABOUT JANUARY BRUV ALL U DO IN JANUARY IS BE A LITTLE DEPRESSED AT THE COLD AND LACK OF HOLIDAY DAYS OFF AND TRY TO MAYBE HIT SOME NICE 60% OFF SALES. THAT’S IT. THAT’S THE HAPPIEST U GON GET IN JANUFVCKINGWARY. “Oh wow this John Elliott jacket is a little on sale lemme cop this” THAT’S THE HIGH POINT OF JANUARY - SPOILER ALERT. NOBODY LOSING 78 POUNDS IN MF JANUARY. THAT’S WHAT U DO IN AUGUST. LITERALLY. MY LIL HOMEGIRL DROPPED LIKE 18 POUNDS IN AUGUST AND I’M LIKE “SEE? ‘Years’ HAVE NOTHING TO DO WITH IT!” GOD RAINS DOWN THE BLESSINGS ON *HIS* TIMELINE NOT ON THE BASIS OF THE GREGORIAN CALENDAR WHICH IS A MAN-MADE CONSTRUCT. NO OFFENSE TO THE GREGORIANS BUT WHO TF ARE THEY ANYWAY? NOBODY CLAIM THEM. GREGORIA AIN’T EVEN A COUNTRY. EXACTLY. NOW GO LIVE YA BEST LIFE AND BE NICE AND GIVE TO CHARITY AND CALL YA MAMA WHO SUFFER FROM DEPRESSION AND BIPOLAR AND TELL HER U LOVE HER AND MAY GOD ALWAYS BLESS U - IN 2018 AND BEYOND - BLESS UP ❤️😍😂

PSA: NEW YEAR MEANS NOTHING. SORRY TO BREAK IT TO U BUT THAT’S FACTUAL. DON’T BE HARD ON YOURSELF FOR WHAT U DIDN’T ACCOMPLISH LAST YEAR. DO...

Birthday, Disney, and Disney World: I am in tears. humansofny Likedad 21,514 others humansofny "My first thought was 'Oh no wasn't ready for a kid. Her mother and I were fuck-ups and addicts. I'd just finished seven years in jail for robbery. But everything changed on Valentines Day, 1992. That's when I found out the baby was going to be a. Right away I started buying all this girly stuff. I was excited. I became more civil. I was going to raise my daughter to be kind and respectful to everyone. So l became that person. And she became that person too. Every day 1 picked her up from school after work. We went to theaters, and museums, and Disney World three different times. Every year on my birthday we dressed up and got tea at the Four Seasons. She ended up being the valedictorian of her class. She went to Duke on a full scholarship. Now she's in law school at NYU. I look at her and I think that she must have done all this by herself. Because I'm kinda 'street grew up in the projects. And she's gone so much farther than l ever could. SoI always thought I had nothing to do with it. But have friends who tell me that I made a big difference. AndI did always teach her to work hard and do her best. And she told me recently, that when she had to write an essay for her SAT, she called it: 'My Father, My Hero." iow all 741comment best parent award of the years goes to.. (If you can’t read it just slide to the next picture) credits; @humansofny
Birthday, Disney, and Disney World: I am in tears.
 humansofny
 Likedad 21,514 others
 humansofny "My first thought was 'Oh no wasn't ready
 for a kid. Her mother and I were fuck-ups and addicts. I'd
 just finished seven years in jail for robbery. But everything
 changed on Valentines Day, 1992. That's when I found out
 the baby was going to be a. Right away I started
 buying all this girly stuff. I was excited. I became more
 civil. I was going to raise my daughter to be kind and
 respectful to everyone. So l became that person. And she
 became that person too. Every day 1 picked her up from
 school after work. We went to theaters, and museums, and
 Disney World three different times. Every year on my
 birthday we dressed up and got tea at the Four Seasons.
 She ended up being the valedictorian of her class. She
 went to Duke on a full scholarship. Now she's in law school
 at NYU. I look at her and I think that she must have done
 all this by herself. Because I'm kinda 'street grew up in
 the projects. And she's gone so much farther than l ever
 could. SoI always thought I had nothing to do with it. But
 have friends who tell me that I made a big difference. AndI
 did always teach her to work hard and do her best. And
 she told me recently, that when she had to write an essay
 for her SAT, she called it: 'My Father, My Hero."
 iow all 741comment
best parent award of the years goes to.. (If you can’t read it just slide to the next picture) credits; @humansofny

best parent award of the years goes to.. (If you can’t read it just slide to the next picture) credits; @humansofny